Comparative and Molecular Analysis of Proline Rich Region in Lentil (Lens Culinaris Medik)

Abstract

Researchers have shown that a novel proline rich protein Play crucial role in drought tolerance in Lentil crops and in other cultivars as an osmolyte that protect macromolecules and membranes. The Proline is one of the most important compound which protects the plants under adverse conditions. Thus, in the present study attempt was made to isolate and characterized Lens culinaris full length proline rich gene. EST Sequences of proline gene (GT-622346.1) from Lens culinaris was retrieved from Genbank. This sequence was used as query against chickpea. Sequence similarity search has shown 90 % similarity with chickpea EST sequence Accesion no. GR 398:344 and 85% similarity with Lens culinaris EST sequence Accession no. GT 622346. Further Expression studies will help to study the role of prol~ne rich protein in response to various biotic and abiotic stress. Forward primer (PrpF) CTTCCA TAACCTTCCT AGTGT and Reverse primer (Prp~) AATGTGGAGAACAAAAGCACA were designed, synthesized and used in PCR amplification. The gene was isolated using gene specific primers designed by primer-3 bioinformatics software, reaction was carried out at optimum condition required for amplification resulted 750bp amplification which was visualized by electrophoresis. The eluted DNA product also showed similarity with same sequence. The positive results were subjected to sequencing and were further in-silico analysis carried out. BLASTp of the lentil sequence have 98% with Phaseolus vulgaris (accession numberCAJ43592), 97% with Cicer arietinum (accession number-XP004506458), 96% with Medicago truncatula (accession number-Q40375) and 91% with Pisum sativum (accession numberCAB63486). There were I 0 conserved repeats of 180 amino acid each in case of Lens culinaris with the repeat sequence "KPPVEKPPVY". The sequence w~s further translated into amino acid sequence and the Interproscan results for proline rich protein in Lens culinaris was found. The attempt to isolate and characterized lentil proline gene and related genes with similar characteristic and development of more tolerant plant against drought having a higher potential to satisfy demands for production by increasing the crop productivity.